Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST238468
Clone ID OST238468
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST238468
Sequence
TGAGATTCCGGCTGTATCTTNTGAACTCCTAGAAGGCAGTGACATCTACTTTCCGAGATTGTGAAGCCTCCCCGGAATCC
AGAGCTAGTTGCCCGGCTAGAGAAGATTAAGATACAGCTAGCCAATGAGGAGTATAAGCGGATCACTCGCAATGTCACTT
GTCAGGATGCACAGTGTGGGGGGACTCTCAGTGACCTGGGAAAGCAAGTGAGGTCAGTGAAGGCTCTGGTCGTCACCATC
TTCAACTTCATTATCACAGTGGCAGCTGCCTTTGTCTGCACTTACCTAGGAAGCCAGTATGTCTTCACAGAAATGGCCTC
GAGAGTGCTGGCTGCATTGATCGTTGCCTCGGTGGTAGGTCTGGCAGAACTGTACGTCATGGTAAGGGCAATGGAAGGAG
AACTGGGCGAGCTGTAACTGGTGTTTCACCATCAGAGTCTGGAAGAAGTGTGGGGAGCCCCAGACTCCATTGCCCATCAC
AGACTCTCAGTCAACCCACAATGCTCTTTGTATTCAGCTCCAGTTAGTCAGAGGACCAGGTCAGGTTCTTTGGGGAGCCT
GTCTGCTGTGAATTTCCTTGGGGAGGAGTAGAGGAGATTCAGACAGTGTTTCTGTAAAACTAAA
Sequence Type mRNA
Unitrap ID UNI8204

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78321005..78323925 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051232 (Tmem199) NM_199199 transmembrane protein 199 Gene [Source:MGI (curated);Acc:Tmem199-001]

 
Come back to gene ENSMUSG00000051232


For any suggestions or comments, please send an email to unitrap@crg.es