Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI189
Clone ID CSI189
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI189
Sequence
AAGGCGCAAGTCATGGCGGAGCAGCGAAGCCCGAGAGGGCCCTGAGCACCGCCGCATGGAGCGGGACGAACGGCCACCTA
GCGGAGGGGGAGGCTGCGGGGGCTAGGAGGGGTTCCTGGAGTTGTTCCGCCGCGCTCCCTCCGCCGCCGCGCAACGGTTT
CTGTCAGGATGAATTGGCAGAGCGAGATCCAGGCAGATAATGGAGAGACAGACAGTTTAACACTTGGCCAAGGCCATATA
CCTGGTCCCA
Sequence Type mRNA
Unitrap ID UNI5735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38728113..38781792 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es