Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST238333
Clone ID OST238333
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST238333
Sequence
AAGAGTGAGCTTTTGCCCTTTTACCTGGNAGGACTCGGGAAAGACCTTTGAATCAGAGGAGGAAGAAACAAACTATTGGA
GAGACCTGGCCATGACCTACAAACAGAGGGCAGAGAATACTCAGGAAGAACTCAGAGAGTTCCAGGAAGGAAGCCGAGAA
TACGAAGCTGAATTGGAGGCTCAGCTGCAGCAGATTGAAACCAGGAACCGGGACCTCTTGTCAGAGAATAACCGCCTTCG
CATGGAGCTGGAGTCTGTGAAGGAGANGNNANNGANNCANCANTCAGNNGGTTACCGGNNCNNCTGACCNTTNNGGGNNG
ACCTGNCCNNAACNAACGCCGTNCANGACCANNTGNGTAANTACATTAGCTGAACTGGAACAAGNCAATGNTGACCTGAN
NNGAGCCANACGAGCCACAATCATGTNCNTGGANGACTTTNANCAGNGTTNGAATNAAGCCNTTGAANGAAATGCCTTCC
TANACAGTGAGCTGNATGAAAANGAGANTCTTCNNNAATCTGTNCANAGGCTGAAGGATGAAGCCCGAGATCTGCGGCAG
GAATTGGCTTGTGCAACANAAGCAAGACAAGCCCCCGGACACCCATGGCCGAA
Sequence Type mRNA
Unitrap ID UNI19459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14169560..14185842 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022678 (Nde1) NP_001107557 nuclear distribution gene E homolog 1 (A nidulans) Gene [Source:MGI (curated);Acc:Nde1-006]

 
Come back to gene ENSMUSG00000022678


For any suggestions or comments, please send an email to unitrap@crg.es