Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0174
Clone ID CH0174
Vector pGT0lxr
Project sanger

Sequence tag CH0174
Sequence
TAACTGCCAGGGCCTCATGCATCTACAGGGCAAACCTGTCTGTTCCTTTGATCCAGAAGGGTTAATTTTTGCTGCGGGCG
TCAACTCAGAAATGGTCAAACTTTATGACCTTCGTTCTTTTGATAAGGGACCATTTGCAACATTTAAGATGCAGTATGAT
AGGACCTGTGAGTGGACAGGACTTAAGTTCAGCAATGATGGCAAATTGATACTCATCTCCACCAACGGCAGCTTTATCCG
ACTGATTGACGCATTCAAGGGTGTGGTGATGCACACATTTGGGGGTTATGCTAACAGCAAAGCTGTGACACTCGAAGCTT
CATTTACTCCAGACTCACAGTTTATTATGATCGGTTCAGAAGACGGCAAAATCCACGTCTGGAATGGAGAGAGTGGTATA
AAAGTGGCTGTATTGGATGGCAAACACACTGGTCCCATTACCTGTTTGCAATTCAACCCCAAGTTTATGACCTTTGCCAG
CGCCTGTTCCAACATG
Sequence Type mRNA
Unitrap ID UNI509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106086509..106088843 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020257 (Wdr82) NM_029896 WD repeat domain containing 82 Gene [Source:MGI Symbol;Acc:MGI:1924555]

 
Come back to gene ENSMUSG00000020257


For any suggestions or comments, please send an email to unitrap@crg.es