Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI382
Clone ID CSI382
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI382
Sequence
GGTTTTTTTAGGGATTTTTTTTTTTTTAGAAGGAGGGGACAGAAGGGGAGGTGAGGATATAGGAGATATGAACGGATAGA
GTGAAGGAAAGGGGAGAGGGAAAGAAAATCGAACAGGAGCTGACGGCTGCCAAGAAGCACGGCACCAAAAATAAGCGC
Sequence Type mRNA
Unitrap ID UNI5107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154483050..154483106 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038467 (Chmp4b) NM_029362 chromatin modifying protein 4B Gene [Source:MGI (curated);Acc:Chmp4b-001]

 
Come back to gene ENSMUSG00000038467


For any suggestions or comments, please send an email to unitrap@crg.es