Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST237777
Clone ID OST237777
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST237777
Sequence
ACCTGAGGGCCGGCTCCAGGNCCTCAGGGTNAGTATGTCTTGCTGGTCTGGCTGGGCATCTTCGTGGGCAGCTGGATGGT
CTACGTGCACTACTCGTCCTATTCAGAGCTCTGCCGTGGGCACGTCTGCCAGGTGGTGATCTGCGACCAGTACCGGAAGG
GCATCATCTCCGGCTCTGTCTGCCAGGACCTGTGTGAGCTGCAAAAGGTGGAGTGGAGGACCTGTCTGTCCTCAGCCCCA
GGCCAGCAGGTGTACAGTGGGCTCTGGCAAGACAAAGAGGTGACCATCAAATGTGGCATTGAGGAGGCGCTGAACTCCAA
GGCTTGGCCAGATGCAGCCCCGAGGCGGGAGCTGGTGCTGTTTGACAAGCCCACCAGGGGAACTTCCATCAAGGAGTTCC
GGGAGATGACCCTCAGCTTCCTCAAGGCTAACTTAGGAGACCTGCCTTCCCTGCCAGCGCTGGTTGACCAGATACTTCTC
ATGGCGGACTTCAACAAGGATAGCAGGGTGTCCCTGGCAGAAGCCAAGTCCGTGTGGGCCCTGCTGCAGCGCAATGAGTT
CCTGCTGTTGCTGTCCCTTCAGGAGAAGGAGCATGCGTCCCGGCTGCTGGGCTACTGCGGGGACCTTGC
Sequence Type mRNA
Unitrap ID UNI23488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26488122..26491258 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036186 (B230317C12Rik) NP_062807 RIKEN cDNA B230317C12 gene Gene [Source:MGI Symbol;Acc:MGI:1927576]

 
Come back to gene ENSMUSG00000036186


For any suggestions or comments, please send an email to unitrap@crg.es