Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST237695
Clone ID OST237695
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST237695
Sequence
TGAGGTGCTTGATGTGTCCGGGGCAGACATATTAGCCAGTCATCTCTAACTCCCAGGTAGAGGTTCTGGAAAACTGTGGC
CATTCGGTAGTGATGGAGAGACCGAGGAAGACAGCCAAGCTCATTGTCGACTTTTTAGCTTCTGTGCATAACACAGACAA
CAAGAAGCTGGACTGAGGCTGTTGCCACAGCTTGCATTGTGCACACAGCATCTGCTCCCATCCCCAAAACCTGACACAGT
AACCACTCTCAGGGATCCTGCCCCAAATGCTGTCTGAGCACCAACAGCCCTGAGGAAGCCAGTTGCCTATCCCAGTATCC
TTGGTTCCACAGAGCATCAGGGGCCACAAGAAACTCTCCAGGATCCTTTTTTT
Sequence Type mRNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8887983..8888355 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

 
Come back to gene ENSMUSG00000025277


For any suggestions or comments, please send an email to unitrap@crg.es