Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST237677
Clone ID OST237677
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST237677
Sequence
GAACCTGGGTATAACCNGCAAACATTGGCTTNGTACCTTGACTATGGAGTCAGACAAATTCATCTGCATTAGAGAAAAAG
TGGGAGAGCAGGCCCAGGTGGTAATCATTGATATGAATGATCCAAGTAATCCAATTCGAAGACCAATCTCAGCAGACAGT
GCCATCATGAATCCTGCCAGCAAAGTGATTGCACTGAAAGGTATAAAGGATTGTGAATGTTTTTCTTGAAATTCTTATGT
GTGTTGTATGCAAATAAAATTACTGACTTGTACTTTTTCTGTTATATGTTGAATAAATTTAATTAGATCTGCAAA
Sequence Type mRNA
Unitrap ID UNI21410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86550458..86550775 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es