Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST237046
Clone ID OST237046
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST237046
Sequence
ACTGAGTATATCTTTGGCGATTTNGCCCTGATGAATTNATCGTTTTTTGTGACTCCCCGCTCTTCTGTTGAGCTCCCTCC
ATACAGTGGGACTCTGTGTAGCATACAGGCTGAAGATGAACTGCCAGATGCAGGACAGGAGCACCAGAGGATCGAGTTTG
GTGTAGATGAAGTCATCGAACCTAGTGAGGGGCTGCCGCCAACTCCTAGCTACAGTATTTCAAGCACCTTGAACCCCCAG
GCACCCGAATTTATCCTTGGTTGTACGACTTCTAAAAAGATCCCTGAAGCCGTTGAAAAAGATGAGACCTACAGCTCCAT
TGACCAGTACCCCGCCTCGGCCTTGGCTCTGGAAAGCAACTCTAACGCAGAGGCTGAGACCCTGGAGAACGACAGTGGTG
CCGGCGGCCTTGGTCAGAGGGAACGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122455747..122465316 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es