Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI133
Clone ID CSI133
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI133
Sequence
TTGGGCTTTCTATTGAAGTGACCATTGAATACCTGCTCTGTTATAGCGATTTTTTCCCGCGGGGATTGAAGTTGGCTTTT
TTTTTTTTTTTTTAACCAATTTCGTGGCGGGAAGAACTGCTGGGTTATTTTCTGTGGCGTTCAAACCTGCGGGCCTTTGC
AATGGAGGAGCAGCCGCGGGAGAGGTCTGAGGCCGGGGCTGAGGCCTGCGAAGAGAA
Sequence Type mRNA
Unitrap ID UNI5761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101545702..101900121 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045273 (Cenph) NM_021886 centromere protein H Gene [Source:MGI Symbol;Acc:MGI:1349448]

 
Come back to gene ENSMUSG00000045273


For any suggestions or comments, please send an email to unitrap@crg.es