Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI158
Clone ID CSI158
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI158
Sequence
CCGGGGTGTTTGTTCCTGCGGAGGAGCCGGCGCCATGGCGGTTCTCTTGGAGACCACTCTGGGCGACGTGGTCATCGACT
TGTACACTGAAGAGCGTCCCCGGGGTCCC
Sequence Type mRNA
Unitrap ID UNI5765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7512715..7512820 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015757 (Ppil4) NM_026141 peptidylprolyl isomerase (cyclophilin)-like 4 Gene [Source:MGI Symbol;Acc:MGI:1914668]

 
Come back to gene ENSMUSG00000015757


For any suggestions or comments, please send an email to unitrap@crg.es