Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST236641
Clone ID OST236641
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST236641
Sequence
ACCTGAGGTGGGGTCTTTNGAGACCGGCTCTGCAACTGGAGGCCCCAGAGCTACCTGTGCAAGTGAACCCGTCCAACCGC
GGAGGGGCAGCTTCGAGGTGACGCTGCTGCGCTCGGACAACAGCCGTGTTGAACTCTGGACTGGTATTAAGAAGGGCCCT
CCACGAAAGCTCAAATTTCCTGAGCCTCAAGAGGTGGTTGAAGAATTGAAGAAGTACCTTTCATAAAGAGGTTGGGAAAG
AGTCCTCATGTTGAGCTTTCAGTCCCTGGAGANGTTGAAGCATTTATGATGGNGCATGGCCAAACTTAAGCTATGCACCT
GAAGCCATAGTTTCTTCCTCACCAGAAGTGATGGTTCAGTTGTGAGGCAGCCCTCCAGCAAGACATTGTANAAGTGTTTC
AATTGTTTAATAAAAGGTCAAGTATCTGAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509375..84510508 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076437 (2700094K13Rik) NM_001033166 RIKEN cDNA 2700094K13 gene Gene [Source:MGI Symbol;Acc:MGI:1919907]

 
Come back to gene ENSMUSG00000076437


For any suggestions or comments, please send an email to unitrap@crg.es