Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI179
Clone ID CSI179
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI179
Sequence
AGGGACAAAGACGGGCAGGTTGACGCCCGTTTCTTTGGACAACATGACAGAGCCTGGGTTCCAGTCAATAATTGCTACCT
CATGTCTAAAGAAATCCCCTTTTCTGTGAAAAAGACTAAAAGTATCTTCAACAGCGCCATGCAAGAGATGGAAGTGTACG
TGGAGAACATACGGAGGAAGTTTGGGGTTTTTAATTACTCCCCGTTCAGGACGCCCTACACGCCCAACAACCAGTACCAA
ATGCTGCTGGATCCCAGCAACCCCAGCGCGGGCACAGCCAAGACAGACAAACAGGAGAAGGTGAAGCTTAATTTTGACAT
GACAGCGTCCCCCAAGATCCTTGTGAGCAAGCCCCTTCTGAGCGGGGGTGCCGGCCGCAGGATCTCCCTGTCCGACATGC
CTCGCTCCCCCACCAGTACGAACTCTTCCGTGCACACGGGCTCCGATGGGAGCAGGA
Sequence Type mRNA
Unitrap ID UNI5045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165653782..165658858 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es