Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST236518
Clone ID OST236518
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST236518
Sequence
CCATCCGGTGCTGGGCCGGAACCTCTNGTTNANAGAGACCCGGCCTGGGAGTGGGCAGCCTGTCCGCTTCTCTGTGCTGC
TGCTGCATGGTATCCGCTTNTCCTCGGAGACCTGGCAGAACCTGGGTACTCTGCAAAGGCTGGCTGAGGCTGGCTACAGG
GCTGNGGNCATTGATCTGCCAGGNCTTGGGCGATCCAAGGAAGCANCAGCCCCTGCCCCTATTGGGGAACCGGCCCCTGN
CAGCTTCCTAGCTGCTGTGGNGGATACCTTGGAGCTGGGACCCCCAGTTGTGATCAGTCCATCATTAANTGGCATGTATT
CACTGCCCTTCCTCGTGGCCCCCGGGTCCCAACTCCGGGGCTTTGTACCAGTGGCTCCTATCTGCACAGACAAAATCAAT
GCTGTGGACTACGCCAGTGTGAAGACTCCAGCTCTCATTGTATATGGAGACCAGGACCCCATGGGCTCCTCCAGCTTTCA
ACACCTGAAGCAGCTGCCCAACCACAGAGTGCTGGTCATGGAAGGGGCAGGGCATCCCTGTTACTTGGACAAGCCTGATG
AGTGGCATAAGGGGCTGCTG
Sequence Type mRNA
Unitrap ID UNI22683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106352380..106354470 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042073 (Abhd14b) NM_029631 abhydrolase domain containing 14b Gene [Source:MGI Symbol;Acc:MGI:1923741]

 
Come back to gene ENSMUSG00000042073


For any suggestions or comments, please send an email to unitrap@crg.es