Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST236327
Clone ID OST236327
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST236327
Sequence
ACCTGAGGCTGGTGTTTGGAATGCTCTATCCGCGTACTATTCCTACAAAGGCCGTGAAGGACGAAAAACGTCAAGGAATA
CGTTCGCTGGATGATGTATTGGATCGTCTTTGCCCTCTACACTGTCATTGAAACGGTGGCCGATCAGACACTTGCATGGT
TTCCCCTGTACTATGAGCTGAAGATTGCCTTCGTCATTTGGCTGCTGTCGCCCTACACTAGAGGGGCGAGTTTAATCTAT
AGAAAGTTCCTTCATCCCCTGCTGTCATCAAAGGAAAGGGAAATTGATGATTATATTGTCCAAGCCAAAGAAAGAGGCTA
TGAGACAATGGTGAATTTTGGACGGCAAGGTTTGAATTTAGCAGCTGCAGCCGCCGTCACTGCAGCAGTGAAGAGCCAAG
GAGCAATAACGGAGCGTCTGCGAAGTTTCAGCATGCATGATCTGACAGCTATCCAAGGGGATGAGCCCGNGGGACACAGA
CCCTACCAGACTTTGCCAGANGCAAAGAGGAAAGGCAAACAAGCCACCGAGTCACCAGCCTATGGAATTCCACTGAAAGA
NGGAAGTGAGCNGACAGACNAANAAGCGGAGGGGCCATTCTCCGATGACNAGATGGNGACTCACAAGGCGCTGAGG
Sequence Type mRNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66477698..66525821 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es