Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI387
Clone ID CSI387
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI387
Sequence
GTTGGTTGTGAGCTCTTCTAGATGGTTTTTTTCAAACTTGGAAGATATCCTTCAACTTCATGTTGGGTTGAATGAGCAAA
TGAAAGCTGTCCGAAAAAGGAATGAAACTTCTGTTATTGATCATATTGGGGAAGATCTGCTCATCTGGTTTAGTGGCCCA
GGAGAGGAGAAGAGGAAACATGCTGATGCCACATTCTGCAGTAACCAACCTTTCGCCCTGGAAATGATCAAGTCTCGCCA
GAAAA
Sequence Type mRNA
Unitrap ID UNI5773

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42794574..42798093 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059495 (Arhgef12) NP_081420 Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

 
Come back to gene ENSMUSG00000059495


For any suggestions or comments, please send an email to unitrap@crg.es