Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI492
Clone ID CSI492
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI492
Sequence
CTGCGCAACTGTTGGTTGTGAGCTCTTCTAGATGGGACGAAGAGTGGGATAAGAACAAGAGCGCGTTTCCGTTCAGTGAC
AAGCTGGGCGAGCTGAGCGACAAGATCGGGAGCACGATCGACGACACCATCAGCAAGTTCCGGAGGAAAGACCGGGAGGA
CTCTCCGGAAAGGTGCAGCGACAGTGATGAGGAAAAGAAAGCAAGAAGAGGTAGATCTCCCAAAGGTGAATTCAAAGATG
AAGAGGAAACGGTGACGACGAAGCATATCCACATCACACAGGCCACAGAGACCACCACAACCCGGCACAAGCGCACAGCA
AACCCTTCCAAAACCATTGATCTTGGAGCAGCAGCACATTACACGGGGGACAAAGCCAGCCCAGATCAGAATGCTTCAAC
CCACACGCCTCAGTCGTCAGCCAAGCCATCGGTGCCGAGCAGCAAGTCCTCGGGGGACCTCGTTGACCTGTTTGATGGCA
GTAGCCAGTCAG
Sequence Type mRNA
Unitrap ID UNI479

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45704150..45708628 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006169 (Clint1) NM_001045520 clathrin interactor 1 Gene [Source:MGI (curated);Acc:Clint1-002]

 
Come back to gene ENSMUSG00000006169


For any suggestions or comments, please send an email to unitrap@crg.es