Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST235598
Clone ID OST235598
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST235598
Sequence
GGCACCCCGCCTCCTACNTGTCTGACCCATTACACTGAATGTTGGGGGGAAGCTCTACACAACCTCACTGGCAACCCTGA
CCAGCTTCCCCGACTCCATGCTGGGGGCCATGTTCAGTGGGAAGATGCCCACCAAGAGGGACAGCCAGGGTAACTGCTTC
ATTGACCGTGATGGCAAAGNGTTCCGCTATATCCTCAACTTCCTGCGGACCTCTCACCTGGATCTGCCAGAGGACTTCCA
GGAGATGGGTCTGCTGCNCAGGGAAGCCGACTTCTACCANGTACAGCCCCTGATCGAGGCCCTGCAGGAAAAAGAGGTAG
AACTCTCCAANGCGGAGAAGAATGCCATGCTTAACATCACCCTGAAG
Sequence Type mRNA
Unitrap ID UNI24079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104495814..104496182 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044952 (Kctd21) NM_001039039 potassium channel tetramerisation domain containing 21 Gene [Source:MGI (curated);Acc:Kctd21-001]

 
Come back to gene ENSMUSG00000044952


For any suggestions or comments, please send an email to unitrap@crg.es