Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST235510
Clone ID OST235510
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST235510
Sequence
AAAGGTCTGAGACTCTAGGTACATGGCACGGAGCCCTTNCGTAACCCAGAATAAGGCAAGCTATGCTTTGAAAGTACCCC
AAGCCACTGGCCGATTTTCTGTGGAGCTGACCCGAGGATCCGGCAGGTTTTGGTCTCACTTTAAGTGGAGGCCGAAATGT
ATCTGGGGATGCTCCATTGACCGTGCATGGACTGCTGAAGGATGGGCCAGCACAGCGATGTGGTCGTTTGCAGGCTGGNG
ACCTNGNGCTCTATATCAATGGCCAGTCAACACAGGGCCTTACTCATGCCCAGGTGGTGGAGAGGATTCGAACTGGAGGC
CCCCACCTTTGCCTGGTACTTCAAAGGCCTCAAGACATGGATGGCAGTAGGATCAAGGAGGTTGGAGGACATCGGAAGAC
AGATCGCAGCCTAGATCCTAGGGGAAGCANGGTGGAGTCTCGCAGNACCATTTCCCCAGTTNACCACCGGCCCAAGACCC
GGACCAGTCCCAGACCTAGTCCATAGGCAGTGGCTATTGGCCACNTGGTTCGCGCANTGGANCACCCCACANAAGACCTG
GAAAACCGTATCCCTGGTACCCCTGGGCCCTGNCTGGTGCCCANCNAGGACCGGCTCTNGCGGNCTCTAGGGGTTCGGGG
TGGGGGGGG
Sequence Type mRNA
Unitrap ID UNI24083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7252074..7253458 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es