Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST235451
Clone ID OST235451
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST235451
Sequence
ACCTACATGGTACCAACTTATTATTACGCCTGGCTAGATGAGGGATCCNCTCCNCCTGTCCTTANATNANGTNNGACACG
CCANGTTNNAANNNTGANCCTGTGATNNCNGNAAAGGNACGGACTGGNGTANTGATTTGTGCATATTTATTGCATCGGGG
CAAATTTTTAAAGGCACAAGAGGCCCTAGATTTTTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTCACAATTCCCA
GTCAGAGGCGCTATGTATATTATTATAGCTACCTGCTAAAAAATCACCTGGATTACAGACCCGTGGCACTGCTGTTTCAC
AAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAA
GATATATTCCTCCAATTCAGGACCCACGCGGCGGGAGGACAAGTTCATGTACTTTGAGTTCCCTCAGCCATTGCCTGTGT
GTGGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGC
Sequence Type mRNA
Unitrap ID UNI18364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32874478..32890065 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es