Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST235191
Clone ID OST235191
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST235191
Sequence
GGGGATTGAAGTTTGTGAGTTGACAAAAGTAAAGTTAAAGTATTGNGGAGTGCATTTTAACTCTCAGGCCATCGCTCCTA
CCATTGAGCAAATTGACCAGNCTTTTGGCGCAACCCATCCTGGAGTGTACAACTNTACTGAGCAGCTCTTNCACCTNAAC
TTCCGAGGACTGNCTTTCTCTTTTCAGTTACCACTCNNGGACGGAGGCTCCCAAGNATGAGNCCACNTNTGNCNATGGTC
TAGTTTTTCTTNAGACACCNCATNGNTCACGNGGAAAACGAATGTACATGAT
Sequence Type mRNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107762322..107764808 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es