Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST234964
Clone ID OST234964
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST234964
Sequence
AGAAGAAGTGTTGCTGATTGTGAAGAAGGTTCGTCAGAAGAGGCATGATGGAGCACTGTACCTCATGGCAGAGAGAATTG
CTTGGGCACCTGGAGGCAAAGACAGATTTACAATCAGCCATATGTATGCAGATATTAAATGTGAGTCATACATGCTAAAA
AAAAAAA
Sequence Type mRNA
Unitrap ID UNI13524

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54057071..54057227 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]

 
Come back to gene ENSMUSG00000006599


For any suggestions or comments, please send an email to unitrap@crg.es