Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST234796
Clone ID OST234796
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST234796
Sequence
TGAGGACCCATATGCTGGTAAGCACNGGAGANGTAGTTANGGCCNGCAGATGNTANTGGATATNATGTGCTNNNGGCGTT
NCAAGCGAAATACACTGACNACAGCTGCCTTGCCTTTTACACAGTCCATCCTCTCTCAGGTGGGTCGTACACTGTCTAAG
GTCCAGCAGGTGCTGAGTTGGTCTTATGGGGAAGATGTGAAGCCTTTTAAGCCCCCCCTGAGTGATGCTGAGTTCCACAC
GTACCTGAATCATGAAGGTCAGCTCTCCCGGCCTGAGGAGTTGCGTTTGAGGATCTACCACGGCGGNGTGGAGCCTTCAC
TTCGAAAAGTAGTATGGCGGTACCTCCTTAATGTGTACCCAGATGGGCTGACTGGCCGTGAGCGGATGGACTACATGAAA
CGTAAGAGCCGAGAGTACGAGCAGCTCAAAAGTGAGTGGGCCCAGCGAGTGAACCCTGAGGACCTGGAATTCATCCGCAG
CACAGTCCTCAAGGATGTGCTCCGCACAGACCGAGCCCATCCCTACTACGCAGGGCCTGAGGATGGCCCACACCTACGGG
CCCTACACGACTTGCTCACCACCTATGCCGTTACCCATCCACAGGTATCATACTGCCAGGGGATGAGTGACCTGGCCTCA
CCAAT
Sequence Type mRNA
Unitrap ID UNI24097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7732876..7733903 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]

 
Come back to gene ENSMUSG00000039201


For any suggestions or comments, please send an email to unitrap@crg.es