Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST234793
Clone ID OST234793
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST234793
Sequence
TGAGGTCTTTGGCCGTATCGATTCCCCTGTCCCAAACATGGGGAATATCTTTGCAAACCTCTTCAAGGGCCTTTTTGGCA
AAAAAGAAATGCGCATTCTCATGGTGGGCCTGGATGCTGCAGGGAAGACAACAATTCTATACAAACTGAAGCTGGGCGAA
ATTGTGACCACCATTCCCACCATTGGTTTCAATGTGGAGACTGNTGAATACAAGAATATCAGCTTCACCGTGTGGGATGT
GGGCGGCCAGGACAAGATCCGGCCGCTGTGGCGCCACTACTTCCANAACACCCAAGGCTTGATCTTCGTAGTGGACAGCA
ATGACAGANAGCGTGTGAACGAGGCCCGTGAAGAGCTCATGAGGATGCTAGCTGAAGATGAGCTCCGAGANGCTGNTCTN
TTGGTGTTTGCCAACAAGCAGGACCTCCCCAATGCCATGAATGCGGCCGAAATCACAGACAAGCTGGGGCTGCACTCTCT
ACGCCACAGGAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGACGGGCTCTATGAAGGACTAGATTGGCTGTCTA
ATCAGCTCCGGAACCAGAAGTGAACCAGACCCCTCCCTCCCCCTCACTT
Sequence Type mRNA
Unitrap ID UNI10213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59026010..59027027 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048076 (Arf1) NM_007476 ADP-ribosylation factor 1 Gene [Source:MGI (curated);Acc:Arf1-001]

 
Come back to gene ENSMUSG00000048076


For any suggestions or comments, please send an email to unitrap@crg.es