Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI209
Clone ID CSI209
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI209
Sequence
AGATTCTGGAAGGCGTCTGTGGCGGCGGCCGCGGGTCTTGATTCCCAGTGATGGCAGGTTCCTCCGCGGAGCAG
Sequence Type mRNA
Unitrap ID UNI154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150785888..150785961 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010755 (Cars) NM_013742 cysteinyl-tRNA synthetase Gene [Source:MGI (curated);Acc:Cars-002]

 
Come back to gene ENSMUSG00000010755


For any suggestions or comments, please send an email to unitrap@crg.es