Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST234370
Clone ID OST234370
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST234370
Sequence
TGAGGTGAAAGTGATCCNAGAGCCTACATAGTGCAAGTCTTGTTTAAAATGGCAATCTGAAGGAAGTCCAGCACCTCAGA
GATTCCCACTTTGATAAGTTTATCGTCCAAGCCGAGAATAAGAGCAAAGAGAAACTTTTCCTTCTACTGAAGTGATGGAG
GCCGGACAGCAGTGGCCTGGGAAGACAGACTTTTATCTGCAATTACCAAAAGTGG
Sequence Type mRNA
Unitrap ID UNI18727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120967827..120968040 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027259 (Adal) NM_029475 adenosine deaminase-like Gene [Source:MGI (curated);Acc:Adal-002]

 
Come back to gene ENSMUSG00000027259


For any suggestions or comments, please send an email to unitrap@crg.es