Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST234343
Clone ID OST234343
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST234343
Sequence
TGAGCATGCTGCATGGGTTGCTGGTAAAACAGGANATGGGAAGGCAGAGTNTGTCCNTGGGAAGAAATGATGTAGTCCAG
CTGAAAGAAGCCTACAAGTGGATAACTCACCCCCTGTTTTCAGAGGAGCTGGGCGTTCCCACTGATGGAAAGAGCTTGTT
CGAAGTGAGCGTGGTCTTTGCTCATCCAGAAACAGCTGAAGATTGCCATTTCCTAGGTGAAGTTTGCCGAGATTGTTTCA
AACCAGCTAAAAATAAACAGTCGGTATTTACCANAANGGCNGTTTTGAAAGCTTTGAGTAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23599928..23608803 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es