Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST234007
Clone ID OST234007
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST234007
Sequence
TTTTTGGGGAAAAAAACCCCCTTTTGGGCCTGTAANAANNCCGATTGTCTTATACCTCATCTGNTAATCTGTCCAAATTG
GTCAGCTGGGCCCACAGCCATGGGACCATTTGCAGCCTCATTCCAAACCTGAAACACTTGCTTTCTGAAGGTTCCCATGG
GAACCTGACTGCAATGTGGGGCTGTAGTGCCGGCCATGCGTACCACTGNTNTTTTTNAGCTACTTGCAGAGCTGGGTCCC
AAGAGAGGGTTTGTTTCCAGGACAACCGAAGTTTTAATTCTGATAGTCCCAGTATAATTGGGGTGCCTTCTGAGACACAG
ACTAGCCCTGTGGAAAGGTACCCTGGGAGACCTGTGAAGGCAAAGCTGGACTGTAATCGGACCAGAGACTCTTGTGACTT
CTCTTACTGCAGTGAGCCCTCTGAACTGGATGAAGCTGTCGAGGAGTATGAAGATGAAAACACACTGTTTGACATGGTTT
GCGAGTCTTCTGTTACAGATGAGGACAGTGACTTTGAACCCCAATGCACATTCCCT
Sequence Type mRNA
Unitrap ID UNI24121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59703032..59703528 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045071 (E130308A19Rik) NM_153158 RIKEN cDNA E130308A19 gene Gene [Source:MGI Symbol;Acc:MGI:2442164]

 
Come back to gene ENSMUSG00000045071


For any suggestions or comments, please send an email to unitrap@crg.es