Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH756
Clone ID CSH756
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH756
Sequence
ATGTAGAATACACAGAAGCGGAAGTGTCCTCCCGTGAGCCTCACCAAGCTCTGGGAACGAGAGCCACAGAGACGGTGTAC
AGTGAGATCCGGACGGTAGACCCTA
Sequence Type mRNA
Unitrap ID UNI5805

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106533056..106540910 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es