Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH755
Clone ID CSH755
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH755
Sequence
TGACTCTGTCCCGTCCATCACAGTGAAGATTACCCTGCAGAACCGAGTGGTGTTGCAGAAGGTCAAGCTGTCTATCTATG
TGCAGCCTCCACTACAGTTGACTTGTGATCAGTTCACCTTTGACTTCACGGTTCCAGATATGACGAGTTCAGTAGCGTTT
TCTGTGTACCTGAAGAGAAACTACACACCATCCGAGTTAGAAGGAAATGCTGTTGTTTCTTACTCCAGACCGACAGGTAT
TCCTCGGGTTGTCCAATGTAAATTTAGACTTCCTCTGAAACTGATTTGCCTACCTGGTCAGCCTTCAAAAACTGCAAGCC
ACAAACTAACTATAGACACCAACAAATCTCCTGTCAGTCCCCTCCCTCTCCCAGTATACTCAACCACCACATCAGATGGG
TGCCAAGTTTATGTAATGGGCTTCCGTCTCCTAGGAGCCGCTAGATTGACTCTTCTTGCTTCCAGAACATCCC
Sequence Type mRNA
Unitrap ID UNI5807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22443200..22463589 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]

 
Come back to gene ENSMUSG00000035919


For any suggestions or comments, please send an email to unitrap@crg.es