Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST233536
Clone ID OST233536
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST233536
Sequence
ACTCACTGACCACTGCACTGTGTGTGTGNCAGGCCTTCAGCTTACCCTGCAGCCCCGCCAGGGTTCAGGACCAGGGGCTG
CGGACTCTCAGAGTTGGGCCTCATGCATNNTNNNTAGCTTGCAGCTGGCTCAAGAGTGCCTTCGGGAAGGGTTGCCAGAA
CCCTCAGAACCACCACAGCCCCTGGAGGGGCTGGAAATG
Sequence Type mRNA
Unitrap ID UNI24130

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6244523..6244817 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024773 (Atg2a) NM_194348 ATG2 autophagy related 2 homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Atg2a-001]

 
Come back to gene ENSMUSG00000024773


For any suggestions or comments, please send an email to unitrap@crg.es