Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH800
Clone ID CSH800
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH800
Sequence
GTCGCCGCGGGCACCGGGACCCCGTCGGTGGGGGCGGCCAGCGCTGCGGACGGCGGCGACGAGACGCGGCTGCCCTTCCG
CCGGGGTATCGCGCTGCTGGAGAGTGGCTGCGTAGACAACGTCCTGCAAGTC
Sequence Type mRNA
Unitrap ID UNI400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108679592..108679723 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]

 
Come back to gene ENSMUSG00000032846


For any suggestions or comments, please send an email to unitrap@crg.es