Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH906
Clone ID CSH906
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH906
Sequence
GCCAATCAGCTGTCAGAGCTCATGATAAATCGCAATGCATTATTGATAATAATAATTACTGGGACATGCGCGTTTCGGCC
GAAGGGGGCTAAAATTTCCCAACTCCAGGAATTGGTGGCGGAGAGGGGGCAAGTCACCAGGGCTCTTCCCGGCGCCCCAA
TGCGCGCACCATGTCGAGGCGCAAGCAGGCGAAGCCCCAGCACATCAACTGGGAGGAGGGCCAGGGCGAGCAGCCTCAGC
AGCTACCGAGCCCCGACCTCGCCGAGGCGCTGGCGGCGGAGGAACCC
Sequence Type mRNA
Unitrap ID UNI1046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168592413..168592699 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es