Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST233086
Clone ID OST233086
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST233086
Sequence
AGATGTGGCGTGGGCTTTCAGAGGAGACTGTGGCAACATCATGTGGTACCAACAGGGCAGTGTTTTCAGTATGTGCACAC
NAAAGTTGGAGACCGAGCGGAGCTCANCAGAGCCTTCACACAGCAGGATGNAGNTACCTTCTCAGAGCCGAT
Sequence Type mRNA
Unitrap ID UNI24141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8922590..8922735 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]

 
Come back to gene ENSMUSG00000023156


For any suggestions or comments, please send an email to unitrap@crg.es