Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH924
Clone ID CSH924
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH924
Sequence
GATGTGCAGATTCTAGCGCGGATGCAGGAAGAAAGTCTCCGGCAAGAATATGCAGCCAGCACCTCTCGCCGCAGCTCTGG
TTCATCTTGCAATTCTACGAGGCGGGGCACTTTTAGTGATCAGGAGCTGGACGCCCAGAGCTTGGATGATGAAGATGACA
GTCTGCAGCATGCAGTACACCCGTGCCCTTAATAGGTTTTCTCCATCCCCACGGAATTCACCACGACCATCTCCTAAGCA
GTCGCCTCGAAATTCACCTCGTTCACGGTCTCCTGCCCGGGGAATAGAATACAGTAGAGCGTCCCCACAGCCTATGATTA
GCCGCTTGCAGCAGCCTCGCCTTTCCCTCCAAGGCCATCCCACAGATTTACAGACGAGCAATGTTAAAAATGAAGAAAAA
CTTAGACGCAGTCTTCCAAACCTATCCCGAACATCGAGCACACAGGTTGACTCTGTGAAAAGCAGTAGAAGTGACTCCAA
TTTTCAAGTGCCAAATGGAGGAATACCTCGAATGCAGCCTCAGGCTTCAGCCA
Sequence Type mRNA
Unitrap ID UNI5816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73346694..73349525 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036087 (Slain2) NM_153567 SLAIN motif family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1923241]

 
Come back to gene ENSMUSG00000036087


For any suggestions or comments, please send an email to unitrap@crg.es