Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232980
Clone ID OST232980
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232980
Sequence
CGGTGTCTCTCTCTTTCGGAAGATNACAAAGCAGTCGAACCTGCTGCACACCAGTCGATCGCTGTCCTCTTTGAACCGGT
CCTTGTCGTCCAGCGACAGTCTTCCGGGCTCGCCCACGCACGGACTACCCGCACGCTCGCCCACACATAGCTATCGCTCT
ACACCTGACTCCGCCTACCTAGGCGCCTNGTNACAGAGTAGCTCGCCAGCTTCCAGCANCGCCTAATTCCCCCGCACTNA
TTNCGCCTNGCACCANATCAGGCCCAGCACCTTGCACGGGCTGTCACCGAAACTACACCGGCAGTACCGCTCAGCGCGCT
GTAAATCGGNTGGCAACATNCCGCTGTCACCTCTAGCGCACACACCATNCCCGACGCAGGCGTTCGCCGNCGCCGCTGNC
AGGCCACACGGGGGGCAGCCTCACATACCACGCAAAGNTTCCCTGCCAAACTACACTNATCGCCACCTGTNGTGCGCCCG
CGCCCCAAAAGNGCAGAGCCACCACGCTCGCCGTTGNTCAAGCGCGTGCAGTCAGCGGAGAAACTAGGGGCTTNNCTGGG
AGCANACAAGAAGGNCGCACTGCGCAAACACAGGCTGGAAGNGGGACACCCTGATTTNCGAAAGGACTTTCATGGTGAGC
TGGCCCTGCATAGCCT
Sequence Type mRNA
Unitrap ID UNI24143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87436672..87437394 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es