Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232910
Clone ID OST232910
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232910
Sequence
ACCTGAGAATGCCCTCTTGCGCAAAAGAGTGAAAATACAGGCCGAGAATGCAGAACCCAAAGATGAATGCTCTTTCTTCT
CTGAGTTGTCATCTGGCTCTGAAGAAGATAACAAGGAAGACAGCATTTGGGAACCTCAGAAGAAAGTTCCCAGAAATCGT
AGACAGCCTGCTTCCAAGGGATCCAAACGGAAGCAGGGGCCCAGGGCGAAGAAGAGCTCCCAACAGGTGGATGACGAATC
AAAAGATGTGGCTGTTAAGGAGGAGTTGAACAGCCCGGTGGCTATTGTTGATGCAGATTTGGAAGAGAAAAGCCACAAGT
TGCAGACGACAAAGACTCTTAAAACTGCAGCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86535787..86541779 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024135 (Srbd1) S1 RNA binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1925836]

 
Come back to gene ENSMUSG00000024135


For any suggestions or comments, please send an email to unitrap@crg.es