Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232785
Clone ID OST232785
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232785
Sequence
TGAGTGCTGAACACGAGTAAACTNTTTTTNGAGTTAAAAAATTATTTAAAAAAACAAGATGGGGACTCCTGGTTCTGGAA
GGAAAAGAACGCCGGTAAAAGATCGATTTTCTGCAGAAGATGAAGCTTTGAGTAACATCGCCAGAGAGGCAGAAGCAAGG
CTAGCAGCAAAGCGGGCCGCCAGGGCAGAAGCAAGAGACATCCGCATGCGGGAACTGGAACGACAGCAGAGAGAGTTGGA
TGAAAAATCTGACAAACAGTATGCTGAAAACTACACAAGACCTTCATCTCGAAATTCTGCCTCGGCTACAACGCCTCTAA
GTGGGAACTCATCCAGACGGGGTAGNGGGGACACCAGCAGCTTAATAGACCCAGACACCTCACTGAGTGAACTGCGGGAC
ATNTATGACCTGAAGGACCAGATTCATGATGTAGAAGGGCGGTACATGCAGGGCCTTAAGGAACTGAAGGAGTCTTTGTC
TGAAGTAGAAGAGAAATACAAGAAAGCCATGGTGTCCAATGCACAACTAGACNATGAGAANAACAATCTGATCTACCAGG
TGGACACCCTCAAGGATGTCATTGAAGAGCAGGAGGAGCAGATGGCAGAGTTTTATANAGAGAACGAAGAGAANTCCAAG
GAGTTAGAAAGGCNGANACACATGTGCAGCGTGCTGCAGCATAAGATGGATGAACTCAAGGAANGCCTTCTGCAGANGGA
CGAGCTNATNGANAAACATGGCTTANTTATAATCCCAGACAGCACTCCCAATGGGNGATGTCCATCATGAACCTGNGGGT
GGGGCCCATTACTGCTGNGTNTTAAGAAGCTGCTCAGGTNTTTGGAGTCANCAAGGAAAAAGGCCCCTTTATGGGGAGGC
TCCGAAAGCTTGGTTGAAAAAAGAC
Sequence Type mRNA
Unitrap ID UNI7156

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 111043692..111116775 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032497 (Lrrfip2) NM_027742 leucine rich repeat (in FLII) interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1918518]

 
Come back to gene ENSMUSG00000032497


For any suggestions or comments, please send an email to unitrap@crg.es