Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232742
Clone ID OST232742
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232742
Sequence
ACCTGAGGACTGCCGNANCTGCNCACGCAGCACGCCAGCCTGCTCTCCATNCTNCGGAAGCGGTNCCGCTCACCAACACC
ACAGCAACCAGGACGGAGACACCATGGTGGNNAAGGGCTCAGATCACTCCTCGGACANGTNCCCGTCCACCCCGGNNCAG
GGTGNGCANCNCAGTTNCTNCTCACAGTCTGGTCGGAGCGGTGGTAAAAATTCCAAGAAAAGCCAGAGTTGGTACAATGT
GCTAAGCCCCACTTACANGCAGANAAATGAAGACTTCAAAAAGCTCTTTAANCANCTTNCAGACACGGAGCGCCTCATTG
GNGATTACTCTTGNGCACTCCAAANANACATTNTTCTTCAGGGCCGACTCTACCTCTCAGAAAATTGGATCTGCTTCTAC
AGCAACATCTTTCCGCTGGGAAACCCTGGTACAGAGCTTGGACTTGGGTTGGTGGGGGATCGTGTGGGATGTAGGTGCTG
CAGCTCAGTGGTGGTACTCTTACCTGGCATGCACAAGGCTTCTCTGTGCTTGGTCCCCAGAATTGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40124321..40141247 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es