Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH682
Clone ID CSH682
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH682
Sequence
GGGCAAGAAGGAGAGAAGTGAAGGCGTGGGGACTTGTTCGGAAAAGGATCCTGGGGTCCTCCAGCCAGTTCCCTTGGGAG
GACGGGGTAGTCAGTATGATGGAAGTGCAGGGATGGACACAGGAACCGTGGAGCCGCTTGGGAGTATAGCTATTGAACCT
GGGGCAGCGCTCAATCCTTTGGGAACTAAGCCGGAGCCAGAGGAAGGGGAGAATGAGTGCCGGCCACTAAAGAAAGTCAA
GTCTGAAAAGATGGAGTCCCCAGTCTCCACCCCAGCGGTGCTGCCACTGCACCTGTTAGTGCCAGTGGTCAATAATGACA
TCTCATCTCCCTGTGAGCAGATCATGGTCCGTACCCGATCAGTTGGTGTCAACACATGCGACGTGGCTCTAGCCACAGAG
CGTGAGTGCTTAGGCCCCTGTGAGCCTGGAACCAGCGTCACCCTAGAATGCATCCGTGTGTCAGGCAACAGAAGCT
Sequence Type mRNA
Unitrap ID UNI5825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65578786..65642678 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]

 
Come back to gene ENSMUSG00000040524


For any suggestions or comments, please send an email to unitrap@crg.es