Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232597
Clone ID OST232597
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232597
Sequence
AGGAGGACTGCCGAAATACTTAGGTAAGCAGCAGAACCGGAGTCCGAGAAGCCTTTACAGGTGGCCAGAGTGGAAAGCAG
TGTCCCACAAACAAAGGAACTGGGAGGCATCACCACCCTTGATGACCCCCTAGGACAAACGCCGGAACTTTTCGATGCCT
TTATCTGCTACTGCCCCAACGATATCGAGTTTGTGCAGGAGATGATCCGGCAACTAGAACAGACAGACTATCGGCTTAAG
TTGTGTGTGTCCGACCGTGACGTCCTGCCGGGCACCTGTGTCTGGTCCATTGCCAGCGAGCTAATTGAGAAAAGGTGTCG
CCGCATGGTGGTGGTTGTTTCTGACGATTATCTACAGAGCAAGGAATGTGACTTCCAGACCAAGTTTGCACTCAGCCTGT
CTCCAGGTGTCCAACAGAAGCGACTGATTCCTATTAAATACAAGGCGATGAAGAAGGACTTTCCCAGTATCCTGCGGTTC
ATCACTATATGCGACTATACCAACCCTTGCACCAAGTCCTGGTTCTGGACCCGCCTTGCCAAGGCTTTGTCCCTGCCCTG
AAGATGACCCTGGGAGCCCTAGGGCAGAGGGGAAGATGAGACTGATGCGGAGCCAGATTCTCTGATGCCGTCCTGTCTAC
ATCTTTGACTCCCCTGGGCTCAACCCGTGTTCAATGATGACTGGCCTGAGCAACTAGGACTGCCTTTCCTCCCAGCCACC
CATGCCTGTGCACGCACCTCAGTACACACATGCCTTCTTGCACACACAGGCATNTGCATATGNGGGGTTTCCTTTGGGGA
CAGCTCCCAAGGATAGCTGAGTGGGAAANAGTTCTATTATTAANGGGGGCCTGGCCATNTNCCTGGACAAAAGGGGGG
Sequence Type mRNA
Unitrap ID UNI16958

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119245727..119247828 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032508 (Myd88) NM_010851 myeloid differentiation primary response gene 88 Gene [Source:MGI (curated);Acc:Myd88-001]

 
Come back to gene ENSMUSG00000032508


For any suggestions or comments, please send an email to unitrap@crg.es