Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232532
Clone ID OST232532
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232532
Sequence
CTGAGGTGCTGGAAACNGTGGAGAGGCTGGGTGAGGCAGTGAAGACGGAGCTGACCNNCTGGAGGAAGTGCTGTCAGTCC
GCATGGAGCTGGTGGCTGCCACCAGGGGAGCCCGAAGGCAGGCTGAAGCTGCTGCTCAGTACCTGCAAGGACTGGCCTTC
TGGCAAGGAGTGTCCCTGAGCCCCGTACAGGTGGCTGAAGATGTGACTTTCGTGGAGGAGTACAGGTGGCTGGCCTATGT
CCTCCTGCTGCTCTTGGTGCTTCTGGTTTGTCTCTTCACCCTCCTGGGCCTGGCAAAGCAGAGCAAATGGCTGGTGGTTG
TGATAACTGNCNTNANTNTCCNGGNGCTNGANNNGAGCTGGGGTNCTATGGGCCTANAGGCTGNCACAGCTGAGGNCCTN
AATGACTTTTGCTCCAACCCAAANACCTATGTGCTTGAACCTGACCCA
Sequence Type mRNA
Unitrap ID UNI24162

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4077123..4081312 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030428 (Ttyh1) NM_021324 tweety homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Ttyh1-005]

 
Come back to gene ENSMUSG00000030428


For any suggestions or comments, please send an email to unitrap@crg.es