Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232486
Clone ID OST232486
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232486
Sequence
CTGCTATAGCTGCTTCCATGGCTGGCAATAAAGGAAGAGGGCGTGCTGCCTACACCTTTAATATCGAAGCTGTTGGATTC
AGCAGAGGGGAGAAGTTACCTGATGTTGTGTTGAAGCCTCCACCCCTGTTTCCTGATACAGACTACAAGCCGGTGCCCCT
GAAAACGGGAGAAGATGAGGATTACATGCTGGCCTTGAAGCAGGAGTTGAGGGAAACAGTGAAACGATTGCCGTACTTTA
TTGAACCACCCGAAGAAAAACAAGGNNNCNTTGCCNGNNATANNCTGGAAGAGGACTGGCGCTNCAGGGCTNNCTGAGAN
ACNAGNNGCNCCAGCNNATCNTTGANNGACCTACCCNGCTTGAGCACCGNNNATATAAATGGNNTGACNNNCCACNNTAG
CAANAAAGGNGAAACATTTATATTTTAACGTAT
Sequence Type mRNA
Unitrap ID UNI22707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81833482..81838877 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035834 (Polr3g) NM_001081176 polymerase (RNA) III (DNA directed) polypeptide G Gene [Source:MGI Symbol;Acc:MGI:1914736]

 
Come back to gene ENSMUSG00000035834


For any suggestions or comments, please send an email to unitrap@crg.es