Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232324
Clone ID OST232324
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232324
Sequence
TGAGTCTTGCCTCCGCATCTCCTCCTCCATCCCGATGCCGAGTGATCTGAAACGCACATATGATCTTGCCACTCCCCTGC
TTAAAACCCACCAACTGCAATGGTTCTGTAACCCCAGGGTAGCCTCTGACAAGGGCTGAAACTATGGGACCCCTGCCCCT
GGCTTCTCCTCCATGCTGTATGGAATGAAGATCGCAAATCTGGCCTTCGTCACCAAGACTCGGGTCAGGTTCTTCAAACT
AGACCGCTGGGCTGATGTGCAGTTACCAGAAAAGAGGCGAATAAAGCCAGGGTCGAACATCAGCAAACAACACAGATCAC
TGTTGGCCAGGATCTTTCACGACAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104607822..104610022 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es