Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST232177
Clone ID OST232177
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST232177
Sequence
ACCTGAGGAGCTCGATGCCCTCCGCAAGTGTGGGAGATNCCCGGGACTGGGAGGAGAGCTGGAACCAGTGGAAGATGGGC
TGCTTCCAGACCCTGCAGACGGAAGCCATGGAGTCCATGGCTCATGGGCTGTTCCGCCGCCTCACGAGACTAGCCAAAGA
GTACAAGGACCGAAACTGGGAAATCATTGAAACGACTCGCTCCAAAATAGAGCAGTTCAAGAGGACCATGCCCCTCATCT
CAGACCTGCGGAATCCAGCCCTCAGAGAGAGGCACTGGGACCAGGTCAAAGAGGAAGTCCAGCGGGAGTTTGATCAGGAG
TCAGAGAGCTTCACCTTGGAGCAGATTGTGAAACTAGGGATGGATCAGCACGTGGAGAAGATTGCAGAGATCTCAGCCTC
TGCGACCAAAGAGCTGGCCATAGAAGTGGGATTACAAAANATTGCCAAGACCTGGGATTNGGCTAGNTAGNACATAGNAC
CCTACAAGGACAAGGGCCATCACCGGCTCAGGGGAACAGAAGAA
Sequence Type mRNA
Unitrap ID UNI24175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69297485..69300837 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005237 (Dnahc2) NM_001081330 dynein, axonemal, heavy chain 2 Gene [Source:MGI (curated);Acc:Dnahc2-001]

 
Come back to gene ENSMUSG00000005237


For any suggestions or comments, please send an email to unitrap@crg.es