Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH934
Clone ID CSH934
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH934
Sequence
AGATCACGCTGCGCAGGTGGGAGAAGTCTGGTGTCTCTGAGCAAAGGCAATCCTTCTTGAAGGGCGAGTGTGTGGAGTCG
CTCCGCACATACCTGGAGATAAGGAAGGAGACTCTGCTAAGAACAGATCCTCCCAAGGCACATGTGACCCATCACCCCAG
ACCTGAAGGTGAAGTCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCTAACATCATCCTGACCTGGCAGTGGGATG
AGGAAGACCTGACTCAGGACATGGACCTCATTGAGACCTGACCTGCAGGGGATGG
Sequence Type mRNA
Unitrap ID UNI5839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37124707..37125575 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]

 
Come back to gene ENSMUSG00000024459


For any suggestions or comments, please send an email to unitrap@crg.es