Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST231887
Clone ID OST231887
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST231887
Sequence
AGGACTACAGGGTTATCAGGGAGATGCTGATGAAAAGGTTACTAANAAGGAAAGAGTGCCTCCTTGTACCTGCCAGACTC
TTGCTCACAATACANAAAAGGCATATGAGTGTAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28487550..28487662 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057093 (C030039L03Rik) NM_198417 RIKEN cDNA C030039L03 gene Gene [Source:MGI Symbol;Acc:MGI:2148237]

 
Come back to gene ENSMUSG00000057093


For any suggestions or comments, please send an email to unitrap@crg.es