Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH964
Clone ID CSH964
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH964
Sequence
ACCCCGACGGAGGTTCCTCACGCTCCCGGGGCCCCGCCGCAGGGCAAAGCCGGAGGTTACAGCAAAGCTGCCGGGGCGAT
GGCTGGAGCGGCTGGAGGCTCGGGCGCGGGGGGCAGCGGAGGTGCCTCGGGCTCCGGGCCGTCGGGCCTGGGTTCTGGAA
GCAAGAAGTCCCCGAGGCTGCCCAAATGCGCTCGCTGCAGGAACCACGGCTACGCGTCGCCGCTCAAGGGCCACAAGCGC
TTCTGCATGTGGCGGGATTGCCAGTGCAAGAAGTGCAGCCTGATTGCGGAGCGACAGCGGGTGATGGCCGCGCAGGTGGC
CCTGAGAAGACAGCAGGCCCAGGAAGAAGAACTGGGTATCAGCCACCCAATTCCGCTGCCCAGCGCAGCCGAGCTCCTGG
TCAAAAGAGAGAATAATGCCAGCAACCCGTGCCTGATGGCCGAGAACAGCAGCTCTGCCCAGCCCCCACCGGCCAGCACC
CCAACCCCCGCTGCCT
Sequence Type mRNA
Unitrap ID UNI5845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25580377..25584350 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024837 (Dmrt1) NM_015826 doublesex and mab-3 related transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1354733]

 
Come back to gene ENSMUSG00000024837


For any suggestions or comments, please send an email to unitrap@crg.es