Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST231494
Clone ID OST231494
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST231494
Sequence
TGAGCCTAGTGGCGACCCCTCNGGCCGGGCCGGCGCAGCACTCGAGGCAAGCGCGGCAAGCTCCTGCGCTCTCCAAAGGA
TCCCGTGCCCCTCGGGGCTGCCGGGTAGGGTAATGCCCTCAGTAATGGAGAAGCCCAGTGCGGGCTCCGGGATCTTGTCC
CGAAGTCGGGCCAAGACGGCACCCAACGGCGGACAGCCACACTCGGAGGATGACAGCAGCGAGGAGGAGCACTCTCATGA
CAGCATGATCCGAGTTGGAACCAATTACCAAGCAGTAATTCCGGAGTGCAAGCCTGAGAGCCCTGCACGCTATAGCAACA
AGGAGCTGAAGGGAATGCTGGTGTGGTCCCCCAACCACTGTGTATCANATGCCAAACGTGAGTGCGCTGGGCCCAGGTCA
CGTTCAGTCTCAGGAACAGGGTTTTAGTTCCTGTCCTCCTAAGGCTAGCTCTTCCTTANAAGTGAGCTGATGCCGGNCA
Sequence Type mRNA
Unitrap ID UNI19263

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7343339..7344773 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024968 (Rcor2) NM_054048 REST corepressor 2 Gene [Source:MGI (curated);Acc:Rcor2-001]

 
Come back to gene ENSMUSG00000024968


For any suggestions or comments, please send an email to unitrap@crg.es