Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST231069
Clone ID OST231069
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST231069
Sequence
ATTTACCTGAGGTGGGGTCTTTCCGCGGCTAANGAANGCTGCCCAGGACAACCGAGGCAAGGTGNCCACATTACTGAAGG
CCCTTATCACCAAGCCGGAACCTGACCTTCCCTGGAAGTATGANGACCTGTCAGAAAAGATGNTTNACACTCTCGGNGAA
CTGGAGACTGTCCGCCTGGACGGGGAAGGGATTACTTGTATCGGGAATTTAGAGAAACTCCGGAATATTCACAGCCTCTA
CCTGCAATCGAATAAGATCCAGCGCATTGAGAACTTGGCATGCATCACCTCCCTGCGCTTCCTGTCTTTGGCAAGAAACC
AAATCAGGCATGTGGAAAACCTCCTTGACCTCCAGTACCTCCAGTTTCTGGACCTGTCTGAGAACCTGATAGAAACGCTG
AAGCTAGATGAGCTCCCTGAGAGCCTTCTCATCCTCAACCTGTGTGGAAATCCCTGCACCAACCAGGAAGGCTACAGGAA
GATGGTGATAGGAGCCCTGCCACTGCTCTTGGACCTGGACAAGCAGCCTATCCTGGAGCGGNGGACCTCAGATGAGGAGG
ATAAATCCTCAGATGATGATGATGAGTTTCCAGAGCTCAATGGCCCCTTCTGCGCANANCGAGGATTCTTNAAGGACTTG
GAGCAGGAACTGC
Sequence Type mRNA
Unitrap ID UNI17313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96896309..96902297 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020878 (Lrrc46) NM_027026 leucine rich repeat containing 46 Gene [Source:MGI (curated);Acc:Lrrc46-001]

 
Come back to gene ENSMUSG00000020878


For any suggestions or comments, please send an email to unitrap@crg.es